View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_low_43 (Length: 258)
Name: NF15038_low_43
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 40652345 - 40652597
Alignment:
| Q |
1 |
tcctagaccatttcatcctatgcgccccaccaccacgtacattctcttcctcattcccttataattactgatcttgaatgttttgtgttgaattgaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652345 |
tcctagaccatttcatcctatgcgccccaccaccacgtacattctcttcctcattcccttataattactgatcttgaatgttttgtgttgaattgaatat |
40652444 |
T |
|
| Q |
101 |
tcaatactcgatttaatttcattgataaaatgaaattgaaaattgaattggagtt-aagatcctctccatatcctcaatgtctatgattttcannnnnnn |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652445 |
tcaatactcgatttaatttcattgataaaatgaaattgaaaattgaattggagttaaagatcctctccatatcctcaatgtctatgattttcattttttt |
40652544 |
T |
|
| Q |
200 |
gatttataagttcataattttttgagttgccataactacaaagagaataatct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652545 |
tatttataagttcataattttttgagttgccataactacaaagagaataatct |
40652597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University