View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_low_51 (Length: 246)
Name: NF15038_low_51
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 40565248 - 40565461
Alignment:
| Q |
13 |
attattctgtgatttgttcatgggttggagccattgtaacacctgcacccacgtcctatgttcttcggcttctctgaattcagcttcataccaaacttct |
112 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40565248 |
attattatgtgattggttcatgggttggagccattgtaacacc---acccacgtcctatgttcttcggcttctctgaattcagcttcataccaaacttct |
40565344 |
T |
|
| Q |
113 |
gtcgcagcctcacatccgaaaaaacaatgcctatcactctcccacatcagctcacaactttcacactcgagggcaggaaccacttctttgaataccaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40565345 |
gtcgcagcctcacatccgaaaaaacaatgcctatcactctcccacatcagctcacaactttcaccctcgagggcaggaaccacttctttgaataccaata |
40565444 |
T |
|
| Q |
213 |
atatgcatacaaatatg |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40565445 |
atatgcatacaaatatg |
40565461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University