View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_low_60 (Length: 213)
Name: NF15038_low_60
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_low_60 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 49 - 213
Target Start/End: Complemental strand, 29211343 - 29211179
Alignment:
| Q |
49 |
tgtttaccacgtataggacatgcaatttcatgttgagtttgaaaatacaatttattttcaaataaaatcaattatacgaaaataaagaaatgcttgcttc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29211343 |
tgtttaccacgtataggacatgcaatttcatgttgagtttgaaaatactttttattttcaaataaaatcaattatacgaaaataaagaaatgcttgcttc |
29211244 |
T |
 |
| Q |
149 |
atcagactcgttattaatttatagctagaatttgggctacagactgcacttctggaataaattac |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29211243 |
atctgactcgttattaatttatagctagaatttgggctacagactgcacttctggaataaattac |
29211179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 29211404 - 29211365
Alignment:
| Q |
1 |
tatgttcatctagatctagaatagactcttacatgatctt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29211404 |
tatgttcatctagatctagaatagactcttgcatgatctt |
29211365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University