View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_high_20 (Length: 254)
Name: NF15039_high_20
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 27 - 238
Target Start/End: Original strand, 5763160 - 5763368
Alignment:
| Q |
27 |
acattcgtgtatcaaatcaaattaaactttacgtgtaaaaatgaatcttgatatgaaaatgaatgagtcagtatttgaataaatacccttgtttattgcc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5763160 |
acattcgtgtatcaaatcaaattaaactttacgtgtaaaaatgaatcttgatatgaaaatgaatgagtcagtatttgaataaatacccttgtttattgcc |
5763259 |
T |
|
| Q |
127 |
attcaacttcccactttactctaacccacaatatggcacataacactgaggttgatgatgaacatgaaagagataacaaagccaaccagaaagtttcatt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5763260 |
attcaacttcccactttactctaactcacaatatggcacataacactgaggt---tgatgaacatgaaagagataacaaagccaaccagaaagtttcatt |
5763356 |
T |
|
| Q |
227 |
ccacaaactctt |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5763357 |
ccacaaactctt |
5763368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University