View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_low_21 (Length: 249)
Name: NF15039_low_21
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 49301689 - 49301824
Alignment:
| Q |
1 |
tttcacttttcgctaatgacacacaattgatgccaactttgcccacatttagttctcccagttattatggatttggccaatctttagtttttgtatgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301689 |
tttcacttttcgctaatgacacacaattgatgccaactttgcccacatttagttctcccagttattatggatttggccaatctttagtttttgtatgttc |
49301788 |
T |
|
| Q |
101 |
cattaaagtnnnnnnnttaatagttgatatcgtaac |
136 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
49301789 |
cattaaagtaaaaaaattaatagttgatatcgtaac |
49301824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 239
Target Start/End: Original strand, 49301889 - 49301927
Alignment:
| Q |
201 |
cttgacctaaagtggtcccaatgtgaatttcaagccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301889 |
cttgacctaaagtggtcccaatgtgaatttcaagccttt |
49301927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University