View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_low_22 (Length: 237)
Name: NF15039_low_22
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 49487163 - 49487006
Alignment:
| Q |
59 |
gtactccggatgaaataggatatctactacaataagaatagtattcctccaattgatgaatgacttgttttgttgcttgccacgtctagtacagtatatg |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49487163 |
gtactccggatgaaatagaatatctactacaataagaatagtattcctccaattgatgaatgacttgtt-----gcttgccacgtctagtacagtatatg |
49487069 |
T |
 |
| Q |
159 |
tttgacttggtctatgtgccttcgggtcttggtcttttttgttctcagttctattttcttgag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49487068 |
tttgacttggtctatgtgccttcgggtcttggtcttttttgttctcagttctattttcttgag |
49487006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 49487226 - 49487185
Alignment:
| Q |
19 |
gagtggattatcgtctatcttcattccgagatttttggaagt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49487226 |
gagtggattatcgtctatcttcattccgagatttttggaagt |
49487185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University