View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15039_low_23 (Length: 229)

Name: NF15039_low_23
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15039_low_23
NF15039_low_23
[»] chr1 (1 HSPs)
chr1 (1-211)||(48953151-48953361)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 48953151 - 48953361
Alignment:
1 aagttggtggatgagaacatgatcattcttagaatgcgaatccgtgagattgagatggtggaaacaaagactaaagatcattctgattggactgaatggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48953151 aagttggtggatgagaacatgatcattcttagaatgcgaatccgtgagattgagatggtggaaacaaagactaaagatcattctgattggactgaatggg 48953250  T
101 agaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgttgatgaacactagacctgccttggttgtgggcat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
48953251 agaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgttgatgaacactagacctgccttggctgtgggcat 48953350  T
201 attagctctgt 211  Q
    |||||||||||    
48953351 attagctctgt 48953361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University