View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_low_25 (Length: 211)
Name: NF15039_low_25
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 7754659 - 7754832
Alignment:
| Q |
21 |
aaaaaagaaccacagtactaacactagtgattcaatcttacaactaataatttgaaaataattaaggaggcaatatacgagaatgatgaagttattaaaa |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7754659 |
aaaaaaaaaccacagtactaacactagtgattcaatcttacaactaataatttgaaaataattaaggaggcaatatacgagaatgataaagttattaaaa |
7754758 |
T |
 |
| Q |
121 |
tacccctttgcgtccgatgtattctgccatttgaccactagcaatggctcccaccatggctccaacattggata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7754759 |
tacccctttgcgtccgatgtattctgccatttgaccactagcaatggctcccaccatggctccaacattggata |
7754832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 32928219 - 32928146
Alignment:
| Q |
121 |
tacccctttgcgtccgatgtattctgccatttgaccactagcaatggctcccaccatggctccaacattggata |
194 |
Q |
| |
|
|||||||||||| |||| |||||||| || |||||||| || || ||||||||||| || || |||||||||| |
|
|
| T |
32928219 |
tacccctttgcgcccgacatattctgctatctgaccacttgctatagctcccaccatagcacccacattggata |
32928146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University