View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_low_26 (Length: 205)
Name: NF15039_low_26
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 40783413 - 40783216
Alignment:
| Q |
1 |
tctctctttatctcaaggtgatacacgtcaatggggatattagcaaaacattttccatatgctacttttttggttaaaaaataccaactact--actagt |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | | | |
|
|
| T |
40783413 |
tctctttttatctcaaggtgatacacgtcaatggggatattagcaaaacatttttcatatgctacttttttggttaaaaaataccaactagtgaagagga |
40783314 |
T |
 |
| Q |
99 |
gaagaggaaataaagtaatatatacctggcagtggcactgtagatggaaacaaacaaatagtagtaactatctaagcaccatgtgggccgagaattat |
196 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783313 |
aaaaaggaaataaagtaatatatacctggcagtggcactgtagatggaaacaaacaaatagtagtaactatctaagcaccatgtgggccgagaattat |
40783216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University