View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15039_low_9 (Length: 418)
Name: NF15039_low_9
Description: NF15039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15039_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 248 - 411
Target Start/End: Complemental strand, 25682587 - 25682424
Alignment:
| Q |
248 |
cagtgtttaatttgtaaatatagataaggaggaacaaaccccgtgattcccgacgaaagagcatatatttcacattacattatattttagagaggtttta |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25682587 |
cagtgtttaatttgtaaatatagataaggaggaacaaaccccgtgattcccgacgaaagagcatatatttcacattacattatattttggagaggtttta |
25682488 |
T |
|
| Q |
348 |
ggtctgcatcagagacagcacagcatcacatttcacagtctcacacacatgacatcctatgcta |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
25682487 |
ggtctgcatcagagacagcacagcatcacatttcacagtctctcacacatgacatcctctgcta |
25682424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 25682819 - 25682662
Alignment:
| Q |
18 |
aataatggtgatatgtattgtattgaaagtgaatttgagtttttt--gtctctttcaatattatttgtaagtgaactccgatgatatatatgatactaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25682819 |
aataatggtgatatgtattgtattgaaagtgaatttgagttttttttgtctctttcaatataatttgtaagtgaactccgatgatatgtatgatactaga |
25682720 |
T |
|
| Q |
116 |
agtttataataatattatgtatgccaagtaataaacaataaatacatctgcctagatc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25682719 |
agtttataataatattatgtatgccaagtaataaacaataaatacatctgcctagatc |
25682662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University