View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503R-Insertion-1 (Length: 40)
Name: NF1503R-Insertion-1
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503R-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 40
Target Start/End: Original strand, 41108101 - 41108136
Alignment:
| Q |
5 |
atcatctcagccattaatcacgctctgatcgcatgg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41108101 |
atcatctcagccattaatcacgctctgatcgcatgg |
41108136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 35702542 - 35702510
Alignment:
| Q |
5 |
atcatctcagccattaatcacgctctgatcgca |
37 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
35702542 |
atcatctcagccgttaatcacgctctgatcgca |
35702510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University