View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503R-Insertion-2 (Length: 44)
Name: NF1503R-Insertion-2
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503R-Insertion-2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.0000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 10190372 - 10190336
Alignment:
| Q |
8 |
aagttatacataaatttcatagtaaatttgaacgatg |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10190372 |
aagttatacataaatttcatagtaaatttgaacgatg |
10190336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University