View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503R-Insertion-4 (Length: 120)
Name: NF1503R-Insertion-4
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503R-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 9 - 117
Target Start/End: Original strand, 48754541 - 48754649
Alignment:
| Q |
9 |
ggtgggatattttgttctagccgtacaaatttgagagctgcaggatttcagctgggactgacgagattttgactcgatttcattttgtatttgtttattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48754541 |
ggtgggatattttgttctagccgtacaaatttgagagctgcaggatttcagctgggactgacgagattttgactcgatttcattttttatttgtttattg |
48754640 |
T |
|
| Q |
109 |
tggtgtgtt |
117 |
Q |
| |
|
||||||||| |
|
|
| T |
48754641 |
tggtgtgtt |
48754649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 49053220 - 49053265
Alignment:
| Q |
12 |
gggatattttgttctagccgtacaaatttgagagctgcaggatttc |
57 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| ||||||| |||| |
|
|
| T |
49053220 |
gggatattttgttctagctgtacaaattcgagacctgcagggtttc |
49053265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 65
Target Start/End: Original strand, 29031644 - 29031700
Alignment:
| Q |
9 |
ggtgggatattttgttctagccgtacaaatttgagagctgcaggatttcagctggga |
65 |
Q |
| |
|
|||| |||||||||||||||| || |||||| |||||||| ||| ||||| |||||| |
|
|
| T |
29031644 |
ggtgagatattttgttctagcagtccaaattcgagagctgtagggtttcatctggga |
29031700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University