View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503R-Insertion-8 (Length: 261)
Name: NF1503R-Insertion-8
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503R-Insertion-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 15835568 - 15835816
Alignment:
| Q |
13 |
ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15835568 |
ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa |
15835667 |
T |
|
| Q |
113 |
acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15835668 |
acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga |
15835767 |
T |
|
| Q |
213 |
ggttacagacgagtttgggggtggtgagtgggttatgggaccatgctag |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15835768 |
ggttacagacgagtttgagggtggtgagtgggttatgggaccatgctag |
15835816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 19796330 - 19796572
Alignment:
| Q |
13 |
ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa |
112 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||| | |
|
|
| T |
19796330 |
ccactcttctttctgtgttttgcgaacttcagaaccttcgagaagacggtagaggatctcagggagatctttgaagtagccaaagtcagcgagagaagga |
19796429 |
T |
|
| Q |
113 |
acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| || || ||||||| |
|
|
| T |
19796430 |
acattggtagctagggttttagggtgattttcatgaaaccagagagcggcggcgtagaagccttctttgttggactttccggtaccgcggacgccacgga |
19796529 |
T |
|
| Q |
213 |
ggttacagacgagtttgggggtggtgagtgggttatgggacca |
255 |
Q |
| |
|
||||||||||||||||| ||| |||||| ||||| |||||||| |
|
|
| T |
19796530 |
ggttacagacgagtttgagggcggtgagagggttttgggacca |
19796572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 19785272 - 19785157
Alignment:
| Q |
13 |
ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa |
112 |
Q |
| |
|
||||||||||||||| |||| |||| | || |||||| ||||| |||||| || || ||||||||||||||||||||||||||| |||| | || || | |
|
|
| T |
19785272 |
ccactcttctttctggatttcacgaattccagaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtcagcaagtgtagga |
19785173 |
T |
|
| Q |
113 |
acattggtagctaggg |
128 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
19785172 |
acattggtagttaggg |
19785157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 53 - 260
Target Start/End: Original strand, 47713422 - 47713629
Alignment:
| Q |
53 |
agaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaaacattggtagctagggttttagggtgattttcatgcaacc |
152 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||||||||| |||| | |||| || || | |||||||||||||||||| | | || |||| |
|
|
| T |
47713422 |
agaagacggtaaaggatttctgggagatctttgaagtaaccaaagtcagcaagggaagggacgttagaagctagggttttagggtggtagtggtgaaacc |
47713521 |
T |
|
| Q |
153 |
agagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacggaggttacagacgagtttgggggtggtgagtgggttatggga |
252 |
Q |
| |
|
| |||||||| |||||||| ||||| || ||||||||||||||| ||||| || |||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
47713522 |
aaagagcagcggcgtagaaaccttcacgatcggacttgccggtaccgcgaacgccgcggaggttacagacgagtttaagggtggtgagtgggttatagga |
47713621 |
T |
|
| Q |
253 |
ccatgcta |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
47713622 |
ccatgcta |
47713629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University