View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503R-Insertion-9 (Length: 276)
Name: NF1503R-Insertion-9
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503R-Insertion-9 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 276
Target Start/End: Complemental strand, 36508975 - 36508708
Alignment:
| Q |
9 |
tacagtgggtaagactcttgaatgctttcttgcaagaagcaaaatggtttgcttctgggaatgttccaaagtcagaggagtatttgaagaatgccatagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36508975 |
tacagtgggtaagactcttgaatgctttcttgcaagaagcaaaatggtttgcttctgggaatgttccaaagtcagaggagtatttgaagaatgccatagt |
36508876 |
T |
|
| Q |
109 |
aagcactggggtacacgtgatacttgtgcatgctttcttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36508875 |
aagcactggggtacacgtgatacttgtgcatgctttcttttgcatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccatt |
36508776 |
T |
|
| Q |
209 |
atatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacatca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36508775 |
atatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgataaggtaggaaaacatca |
36508708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 37339314 - 37339264
Alignment:
| Q |
224 |
aaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacat |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
37339314 |
aaaattctaaggttatgtgatgacttggaaagcgacaaggtaagaaaacat |
37339264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 37339997 - 37339930
Alignment:
| Q |
146 |
ttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccattatatc |
213 |
Q |
| |
|
|||| ||||||| ||| ||||| ||| ||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37339997 |
ttttacatgggtaaagatataattgaaaaaaccgagtctctaatggacaacttccctaccattatatc |
37339930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University