View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-24 (Length: 250)
Name: NF1504-Insertion-24
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-24 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 31441228 - 31440988
Alignment:
| Q |
7 |
attatgaagcatcaagaaatagtcaatggggaccacgtatatatgtaaaagatggagtgtaagatttattttcatattgaattatcggtgaggctgcaca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31441228 |
attatgaagcatcaagaaatagtcaatggggaccacgtatatatgtaaaagatggagtgcgagatttattttcatattgaattatcggtgatgctgcaca |
31441129 |
T |
|
| Q |
107 |
tacatgcgtatagtagctcatatgagtccaaactccaaacgcataataagatgaataaaactacttatgcatgcatggggattgttgtaagtgtattgat |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441128 |
tacatgcgtatag---ctcatatgagtccaaactccaaacgcatgataagatgaataaaactacttatgcatgcatggggattgttgtaagtgtattgat |
31441032 |
T |
|
| Q |
207 |
accgttgttgactagccggaaatcttcatagttgctttctcata |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441031 |
accgttgttgactagccggaaatcttcatagttgctttctcata |
31440988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University