View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-25 (Length: 245)
Name: NF1504-Insertion-25
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 245
Target Start/End: Original strand, 11687610 - 11687848
Alignment:
| Q |
8 |
ggaaatacgtgacatcggcaaagggattcgttcaattcctctgaatttcacatctagaggttcaactttcggtacttcataagaaaccggcggacctaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11687610 |
ggaaatacgtgacatcggcaaagggattcgttcaattcctctgaatttcacatctagaggctcaactttcggtacttcataagaaaccggcggacctaaa |
11687709 |
T |
|
| Q |
108 |
tattccgaagctgttgagtagtcaagattagaagcgtcatcaggaacagaagcacccggcggaagcatcttcttcaccacttccttccaattatctcccc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11687710 |
tattccgaagctgttgagtagtcaagattagaagcgtcatcaggaacagaagcacccggcggaagcatcttcttcaccacttccttccaattatctcccc |
11687809 |
T |
|
| Q |
208 |
tattatgatcc-tatctttgtaatcaccaacaccactta |
245 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11687810 |
tattatgatccatatctttgtaatcaccaacaccactta |
11687848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University