View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-26 (Length: 274)
Name: NF1504-Insertion-26
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 274
Target Start/End: Complemental strand, 37584820 - 37584550
Alignment:
| Q |
8 |
gaaacagtgtgttcaccaatggcatcagtattccgtagggtaatgttgaaattatcagcaccgcggtggtcggagctcataaacatctccattgtggatg |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584820 |
gaaacagtgtgttcgccaatggcatcagtattccgtagggtaatgttgaaattatcagcaacgcggtggtcggagctcataaacatctccattgtggatg |
37584721 |
T |
|
| Q |
108 |
aatttgtgtggggaatcgttacggctttcgagtcagtcgctcttgtctctatgctctgcttcttcttcctgtcctatggctgcaccatctgatccataac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584720 |
aatttgtgtggggaatcgttacggctttcgagtcagtcgctcttgtctctatgctctgcttcttcttcctgtcctatggctgcaccatctgatccataac |
37584621 |
T |
|
| Q |
208 |
accaagaagctattgtc----cctcatgcatgtgaatcnnncgttttttcttctcttgagtagtttttccc |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37584620 |
accaagaagctattgtccctccctcatgcatgtgaatctggcgttttttcttctcttgagtagtttttccc |
37584550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University