View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-31 (Length: 142)
Name: NF1504-Insertion-31
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-31 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 9e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 72 - 142
Target Start/End: Original strand, 15164093 - 15164163
Alignment:
| Q |
72 |
ttccttcatttcattcattatgttagaaacaattgcgggattggaggtttaattataggggtttttagtaa |
142 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15164093 |
ttcctacatatcattcattatgttagaaacaattgcgggattggaggtttaattataggggtttttagtaa |
15164163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 3e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 44184990 - 44185044
Alignment:
| Q |
8 |
tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
62 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44184990 |
tttgttctattccattgttatcttttggatcaaacaccgcacaacttttattgtt |
44185044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 10420820 - 10420874
Alignment:
| Q |
8 |
tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
62 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
10420820 |
tttgttctgttccattgttatcttttggatcaaacactgcacaatttttattgtt |
10420874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 8e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 35341694 - 35341640
Alignment:
| Q |
8 |
tttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
62 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35341694 |
tttgttctgttccattgttatcttttggatcaaacaccgcacaacttttattgtt |
35341640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University