View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-33 (Length: 116)
Name: NF1504-Insertion-33
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-33 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 34375673 - 34375779
Alignment:
| Q |
10 |
aaccacatattacaccatcagattttcatttgttaaattgagaaccatgccatttgaattaatgagactcatttaatagattctctacacactcccttta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375673 |
aaccacatattacaccatcagattttcatttgttaaatttagaaccatgccatttgaattaatgagactcatttaatagattctctacacactcccttta |
34375772 |
T |
|
| Q |
110 |
gccttgt |
116 |
Q |
| |
|
||||||| |
|
|
| T |
34375773 |
gccttgt |
34375779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University