View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-35 (Length: 178)
Name: NF1504-Insertion-35
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-35 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 14782366 - 14782196
Alignment:
| Q |
8 |
gtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782366 |
gtttattgggtgacggttatggctaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga |
14782267 |
T |
|
| Q |
108 |
tttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt |
178 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782266 |
tttgcatgacagctttgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt |
14782196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 14774489 - 14774319
Alignment:
| Q |
8 |
gtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgacatcttcattaactggtggga |
107 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14774489 |
gtttattgggtgacagttatggctaatgtggtgacgtggcagttttgttttatgggaactgctggaatggtgtttttgacatcttcattaactggtggga |
14774390 |
T |
|
| Q |
108 |
tttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt |
178 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |||||| | || | ||||||||||||||||||| |
|
|
| T |
14774389 |
tttgtatgacagctttgttgtctatgaatgtgttgggaggtgttttggtgtttagagatgcatttggtggt |
14774319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University