View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-36 (Length: 109)
Name: NF1504-Insertion-36
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 44858509 - 44858408
Alignment:
| Q |
8 |
ccttcatcatcttcttcaatggcgccgagaccgctgcagattagggataatccatcggtgtccatggtgttggggttttgagagaacgaagagatttggg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44858509 |
ccttcatcatcttcttcaatggcgccgagaccgctgcagattagggataatccatcggtgtccatggtgtttgggttttgagagaacgaagagatttggg |
44858410 |
T |
|
| Q |
108 |
ga |
109 |
Q |
| |
|
|| |
|
|
| T |
44858409 |
ga |
44858408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University