View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504-Insertion-40 (Length: 93)
Name: NF1504-Insertion-40
Description: NF1504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504-Insertion-40 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 11 - 93
Target Start/End: Original strand, 37088901 - 37088983
Alignment:
| Q |
11 |
atagtgtccttcatattcataatctagaaaatggtaaaccaaaagaaataaggaaaagtgatttaatctatcttcattggaat |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
37088901 |
atagtgtccttcatattcataatctagaaaatggtaaaccaaaagaaataaggaatagagatttaatctatcttcattggaat |
37088983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University