View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15040_low_25 (Length: 270)
Name: NF15040_low_25
Description: NF15040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15040_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Original strand, 54494182 - 54494422
Alignment:
| Q |
14 |
attatactgcattaaattggattggaataagttttttaaatgagtgatccaaactgaatccaaccataggtgattttgtctttgaatcagaattaccaaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54494182 |
attacactgcattaaattggattggaataagttttttaaatgagtgatccaaactgaatccaaccataggtgattttgtctttgaatcagaattgccaaa |
54494281 |
T |
|
| Q |
114 |
atcgcacctcgaacactactagcagaaagctttcccaactattgtcataactatgaagcttctcttcaatgaaagcatcctcacccaatgacaatttctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54494282 |
atcgcacctcgaacactactagcagaaagctttcccaactattgtcataactatgaagcttctcttcaatgaaagcatcctcacccaatgacaatttctt |
54494381 |
T |
|
| Q |
214 |
gtcaccgtgtctacaagtaaacaatgtcatcacctctcata |
254 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
54494382 |
gtcaccgagtctacaagtaaacaatgccatcacctctcata |
54494422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University