View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15040_low_30 (Length: 251)
Name: NF15040_low_30
Description: NF15040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15040_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 43 - 233
Target Start/End: Complemental strand, 36711876 - 36711685
Alignment:
| Q |
43 |
ctttagtgcaaagccttcatttaatttatttctaaaatcacgaggggtatctctcatgttgaagttcatttgtggtttttgtaaat-aaataaaaagttc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
36711876 |
ctttagtgcaaagccttcatttaatttatttctaaaatcacgaggggtatctctcatgttgaagttcatttgttgtttttgtaaataaaaaaaaaagttc |
36711777 |
T |
 |
| Q |
142 |
atttattgttattcataacacattatttttatcacctcaaaaaataaggatttggatttcctgctattgcagcaggatgctataacatatca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||||||| | || |||| |||||| |||||||||| |
|
|
| T |
36711776 |
atttattgttattcataacacattattttcatcacctcaaaaaacacgaatttggatttcctgttgttagagcaagatgctgtaacatatca |
36711685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University