View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15040_low_8 (Length: 526)
Name: NF15040_low_8
Description: NF15040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15040_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 3e-83; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 300 - 514
Target Start/End: Complemental strand, 19728794 - 19728583
Alignment:
| Q |
300 |
gcgattagattaccttttttccgagtctttcgtgttttcttctcagaaccatctccagagggagatgagccttctacaatagaagcactatctacattta |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19728794 |
gcgattagattaccttttttccgagtctttcgtgttttcttctcagaaccatccccagagggagatgagccttctacaatagacgcactatctacattta |
19728695 |
T |
 |
| Q |
400 |
tcaacaaatcaattgcctcttcaggagactccgctttcgattttttcttcgtcgtctttgccgacaccttcttaggtttagatgccttagttgctttcct |
499 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || | |||||||||| | |||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
19728694 |
ccaacaaatcaattgccccttcaggagactcatctattgattttttct---tagtctttgccgacaccttcttaggtttagatgctttagttgctttctt |
19728598 |
T |
 |
| Q |
500 |
ttccaccacaggttc |
514 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19728597 |
ttccaccacaggttc |
19728583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 19729093 - 19728965
Alignment:
| Q |
1 |
atgtcctctccatcatatttttccagatccaaaccatcgtcaatctcatcctccacattttcaataaaggaaggctcgtctatgtcaccgatttcggctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19729093 |
atgtcctctccatcatatttttccagatccaaaccatcgtcaatctcatcctccacattttcaataaaggaaggctcgtctatgtcactgatttcggctt |
19728994 |
T |
 |
| Q |
101 |
caccaccacctttatcctctaaaattata |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19728993 |
caccaccacctttatcctctaaaattata |
19728965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 203 - 237
Target Start/End: Complemental strand, 19728891 - 19728857
Alignment:
| Q |
203 |
cagaactagatgcatctataaaccatatcaaggtt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19728891 |
cagaactagatgcatctataaaccatatcaaggtt |
19728857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University