View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15042_high_25 (Length: 247)
Name: NF15042_high_25
Description: NF15042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15042_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 26 - 228
Target Start/End: Original strand, 4137582 - 4137784
Alignment:
| Q |
26 |
aaatcttggtattccggtctagatgagatcgcgtaccttttttaatctttagtatcgcgaaccaaatcaagattgcataccgttttaaaaatgttggtaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4137582 |
aaatcttggtattccggtctagatgagatcgcgtaccttttttaatctttagtatcgcgaaccaaatcaagattgcatacctttttaaaaatgttggtaa |
4137681 |
T |
 |
| Q |
126 |
atccttaaagcaaattataacaaattgaaatcctatcatgaaccttaaataaaatacctgaagaccagcccatcctttttgaatgtcatcttcactagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4137682 |
atccttaaagcaaattataacaaattgaaatcctatcatgaacctaaaataaaatacctgaagaccagcccatcctttttgaatgtcatcttcactagtg |
4137781 |
T |
 |
| Q |
226 |
tcg |
228 |
Q |
| |
|
||| |
|
|
| T |
4137782 |
tcg |
4137784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University