View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15042_high_26 (Length: 242)
Name: NF15042_high_26
Description: NF15042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15042_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3018911 - 3018685
Alignment:
| Q |
1 |
tggattaaaatttgtgagattttcttttttaaccatccaatcttttcattttgcgtgtcttacaacaattcagattatatatctcgaatattataaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3018911 |
tggattaaaatttgtgagattttcagttttaatcatccaatcttttcattttgcgtgtcttacaacagttcagattatatatctcgaatattataaaaac |
3018812 |
T |
 |
| Q |
101 |
-acccacgaacaccctataacatttcaaattt-ataatctgaatcagttaggaaggatgagaaaataaacacttttacttataggaaactttggttcacc |
198 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| || |
|
|
| T |
3018811 |
aacccacaaataccctataacatttcaaatttcattatctgaatcagttaggaaggatgagaaaataaacacttttatttataggaaactttgattcccc |
3018712 |
T |
 |
| Q |
199 |
gaaaacgtctatgtttgaaattaatga |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3018711 |
gaaaacgtctatgtttgaaattaatga |
3018685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University