View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15042_low_17 (Length: 291)
Name: NF15042_low_17
Description: NF15042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15042_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 280
Target Start/End: Complemental strand, 7128326 - 7128063
Alignment:
| Q |
17 |
agttatcatgtcagttgtgattatgggatatttaccgagtggcggctatgagagggagagaccaagctctagaattattgcaagggacagatcaagacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128326 |
agttatcatgtcagttgtgattatgggatatttaccgagtggcggctatgagagggagagaccaagctctagaattattgcaagggacagatcaagacta |
7128227 |
T |
 |
| Q |
117 |
ttgaatttcttgactagtgtgtgtaaatgtttagaccatctctttcttggataacaacagactatcttaaaagtgaggcagataggaagcaaacaagatc |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128226 |
ttgaatttcttgactagcgtgtgtaaatgtttagaccatctctttcttggataacaacagactatcttaaaagtgaggcagataggaagcaaacaagatc |
7128127 |
T |
 |
| Q |
217 |
caacggaagagatagacttttattagcaacaattccgtagattaaagtgatcagagagagagaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128126 |
caacggaagagatagacttttattagcaacaattccgtagattaaagtgatcagagagagagaa |
7128063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 128
Target Start/End: Complemental strand, 13218802 - 13218744
Alignment:
| Q |
70 |
gggagagaccaagctctagaattattgcaagggacagatcaagactattgaatttcttg |
128 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||| | | ||| |||||||||||| |
|
|
| T |
13218802 |
gggagagaccaagctctcgaattcttgcaagggagagacccaaactcttgaatttcttg |
13218744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 27869374 - 27869435
Alignment:
| Q |
69 |
agggagagaccaagctctagaattattgcaagggacagat-caagactattgaatttcttga |
129 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||| |||| ||||||| | ||||||||||| |
|
|
| T |
27869374 |
agggagagaccaagctcttgaattcttggaagggagagatgcaagactctcgaatttcttga |
27869435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University