View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15042_low_32 (Length: 212)
Name: NF15042_low_32
Description: NF15042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15042_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 41896153 - 41895998
Alignment:
| Q |
1 |
atttagatatgggtgtataattaacctcagttgtttgtggtggataagctaggttatgaacttggccttgatggatcttagggttttgagaagcagattg |
100 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896153 |
atttagatatggtgttataattatcctcagttgtttgtggtggataagctaggttaagatcttgtccttgatggatcttagggttttgagaagcagattg |
41896054 |
T |
|
| Q |
101 |
agggaaattattttgtgctgtagcaagatcaggattaatgataatattttttgtta |
156 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896053 |
agggaaattattttgtgttgtagcaagatcaggattaatgataatattttttgtta |
41895998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University