View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15043_high_4 (Length: 214)
Name: NF15043_high_4
Description: NF15043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15043_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 6691420 - 6691240
Alignment:
| Q |
18 |
atgtttggttataagtgtcaggtgatggtataactagaagtaataaagagtagcttttgtgataggttgaaaacttttacactaattttacatcaaactt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
6691420 |
atgtttggttataagtgtcaggtgatggtataactagaagtgataaagagtagcttttgtgataggttgaaaacttt-acactaattttatatcaaactt |
6691322 |
T |
 |
| Q |
118 |
gctttcaaagtaataacttcactttaaagttcaaactcatttaccaagtcagctttacacaaccaattcctttcaaattcat |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6691321 |
gctttcaaagtaataacttaactttaaagttcaaactcatttaccaagtcagctttacacaaccaattcctttcaaattcat |
6691240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University