View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15043_low_3 (Length: 233)
Name: NF15043_low_3
Description: NF15043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15043_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 24648964 - 24649141
Alignment:
| Q |
19 |
gtcatgtgcagggaatatccattagaatttagaacgtcttgaaaaatctccacccacgtgtcctttttagattattatattaatttatgtgctaaaatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24648964 |
gtcatgtgcagggaatatccattagaatttagaacgtcttgaaaaatctccacccacgtgtcctttttagattattatattaatttatgtgctaaaatga |
24649063 |
T |
 |
| Q |
119 |
acatctaaaaatgtctatggtcgatccagacacaaagctatcttaatatgaaaatgacatttcttagtactactgtat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649064 |
acatctaaaaatgtctatggtcgatccagacacaaagctatcttaatatgaaaatgacatttcttagtactactgtat |
24649141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University