View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15044_high_6 (Length: 226)
Name: NF15044_high_6
Description: NF15044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15044_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 75 - 155
Target Start/End: Original strand, 433057 - 433137
Alignment:
| Q |
75 |
acaaaactccaagattgcactagggaaaaaatctcaaaatctttgcaacacaagagctactcttgcatggtaacaagacca |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
433057 |
acaaaactccaagattgcactagggaaaaaatctcaaaatctttgcaacgcaagagctactcttgtatggtaaaaagacca |
433137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University