View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15046_high_11 (Length: 217)
Name: NF15046_high_11
Description: NF15046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15046_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 54712492 - 54712572
Alignment:
| Q |
19 |
atgggatgggtaattagacatggacacccttttaattgtaccactcc--tatgtggcatggactttatagtattttcacac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
54712492 |
atgggatgggtaattagacatggacaccctttttcttgtaccactcctatatgtggcatggactttatagtatttttacac |
54712572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 54712646 - 54712686
Alignment:
| Q |
160 |
catcctctttccttcatatcacacctctgggtaatgggttt |
200 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
54712646 |
catcctctttctttcatgtcacacctctgggtaatgggttt |
54712686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 41664166 - 41664238
Alignment:
| Q |
25 |
tgggtaattagacatggacacccttttaattgtaccactcctatgtggcatggactttatagtattttcacac |
97 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41664166 |
tgggtaattagacatggacaccatttcttttgtaccactcctatgtggcatgggctttatagtattttcacac |
41664238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 41664389 - 41664429
Alignment:
| Q |
160 |
catcctctttccttcatatcacacctctgggtaatgggttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41664389 |
catcctctttccttcatatcacacctctgggtaatgggttt |
41664429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 32976781 - 32976738
Alignment:
| Q |
54 |
ttgtaccactcctatgtggcatggactttatagtattttcacac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32976781 |
ttgtaccactcctatgtggcatggactttatagtattttcacac |
32976738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 200
Target Start/End: Complemental strand, 32972571 - 32972531
Alignment:
| Q |
160 |
catcctctttccttcatatcacacctctgggtaatgggttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32972571 |
catcctctttccttcatatcacacctctgtgtaatgggttt |
32972531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 77
Target Start/End: Original strand, 31887946 - 31887985
Alignment:
| Q |
37 |
catggacacccttttaattgtaccactcctatgtggcatgg |
77 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31887946 |
catggacacccttttatttgtaccac-cctatgtggcatgg |
31887985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University