View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15046_low_14 (Length: 205)
Name: NF15046_low_14
Description: NF15046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15046_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 6922171 - 6922001
Alignment:
| Q |
17 |
acaaggtaaccacatctttaaaatt-ggtccaaatatatcaacttgttatgactcacttttacttatattttgtaacggaagggataccaacttatacca |
115 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| || || |
|
|
| T |
6922171 |
acaagataaccacatctttaaaatttggtccaaatacatcaacttgttatgactcacttttacttatattttgtaacggaaggca--ccaacttgtatca |
6922074 |
T |
|
| Q |
116 |
aatacatcaacttgtaccaactcactcttactctgttgcactccactacgttcttgacgttcagccagctctc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
6922073 |
aatacatcaacttgtaccaactcactcttactctgtcgcactccactacgttcttgatgttcagctagctctc |
6922001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University