View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15048_high_18 (Length: 242)
Name: NF15048_high_18
Description: NF15048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15048_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 31935857 - 31935616
Alignment:
| Q |
1 |
cggaggtgtccctcggagctgagtgtggacggtggtgacgcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattgttgtagtggcgcgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935857 |
cggaggtgtccctcggagctgagagtggacggtggtgacgcgtgtaatagcgcgtgtggcgcgtttgggacaccggagtattgttgtagtggcgcgtttg |
31935758 |
T |
|
| Q |
101 |
gttcgccatcgagttgttcgccttcggtttattcggaaatgtttaaatctgcttgtcctaaatcttatagctatgcgtttgatgatgctacgagtacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935757 |
gttcgccatcgagttgttcgccttcggtttattcggaaatgtttaaatctgcttgtcctaaatcttatagctatgcgtttgatgatgctacgagtacttt |
31935658 |
T |
|
| Q |
201 |
tacttgtactgctgcggatgattatactatcacattttgtcc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935657 |
tacttgtactgctgcggatgattatactatcacattttgtcc |
31935616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 39 - 219
Target Start/End: Complemental strand, 27975539 - 27975359
Alignment:
| Q |
39 |
cgcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattgttgtagtggcgcgtttggttcgccatcgagttgttcgccttcggtttattcggaa |
138 |
Q |
| |
|
||||||||| |||||||||| || ||||| | || |||||||||||||||||||||| |||||| || ||| |||| || ||| |||| |||||| |
|
|
| T |
27975539 |
cgcgtgtaagagcgcgtgtgaggcttttggtagtcctgagtattgttgtagtggcgcgtatggttcaccggcgacttgtagaccgtcgatttactcggaa |
27975440 |
T |
|
| Q |
139 |
atgtttaaatctgcttgtcctaaatcttatagctatgcgtttgatgatgctacgagtacttttacttgtactgctgcggat |
219 |
Q |
| |
|
||||||||| |||||| |||| ||| |||||||| || | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27975439 |
atgtttaaaaatgcttgccctagatcgtatagctacgcttatgatgatgcttcgagtacttttacttgtactgctgcggat |
27975359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 99
Target Start/End: Original strand, 8810723 - 8810782
Alignment:
| Q |
40 |
gcgtgtaatagcgcgtgtggtgcgtttgggacaccggagtattgttgtagtggcgcgttt |
99 |
Q |
| |
|
||||||||||| || ||||| |||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
8810723 |
gcgtgtaatagtgcttgtggcgcgtttgggaaaccggaatattgttgtaacggcgcgttt |
8810782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University