View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15048_low_27 (Length: 219)
Name: NF15048_low_27
Description: NF15048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15048_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 35 - 205
Target Start/End: Complemental strand, 14039216 - 14039046
Alignment:
| Q |
35 |
acaagttcgatccagtccgggaacgagaaatctccaacaagttcgatcgagtctgggaacgagaaatctccactgcctgaggagatggatacatctgggg |
134 |
Q |
| |
|
|||||| ||||| | || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14039216 |
acaagtccgatcgaatctgggaacgagaaatctccaacaagtccgatcgagtctgggaacgagaaatctccactgcctgaggagatggatatatctgggg |
14039117 |
T |
 |
| Q |
135 |
gacatgtgaacttcacagccaacaatgttagaattggtgttattatttcttttgttttgatggtgtttttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14039116 |
gacatgtgaacttcacagccaacaatgttaggattgttgttattatttcttttgttttgatggtgtttttg |
14039046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 14039276 - 14039181
Alignment:
| Q |
11 |
gattatactatcactttttgtcccacaagttcgatccagtccgggaacgagaaatctccaacaagttcgatcgagtctgggaacgagaaatctcca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
14039276 |
gattatactatcactttttgtcccacaagttcgatccagtccgggaacgagaaatctccaacaagtccgatcgaatctgggaacgagaaatctcca |
14039181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University