View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15049_low_7 (Length: 204)
Name: NF15049_low_7
Description: NF15049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15049_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 15192294 - 15192462
Alignment:
| Q |
18 |
acttgacatgggggtattatttttgggaaacaatcttttatcttggaaggtaaataaatacatttaaagaacacaattttttgaaaaatattttaaatgg |
117 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
15192294 |
acttggcatggggatattatttttgggaaacaatcttt-atcttggaaggtaaataaatacatttaaagaacacaattttttggaaaataatttaaatga |
15192392 |
T |
|
| Q |
118 |
tttattaatccaagactaacatttgttttaaaaaagtttgtcttacattttggtacagcatgattggagct |
188 |
Q |
| |
|
| |||| ||||||||||||| ||||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
15192393 |
tgtattgatccaagactaaccattgtttt-taattttttgtcttgcattttggtacagcatgattggagct |
15192462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 15182345 - 15182408
Alignment:
| Q |
18 |
acttgacatgggggtattatttttgggaaacaatcttttatcttggaaggtaaataaatacattt |
82 |
Q |
| |
|
||||| |||||||||| ||||||||||| | | ||||| |||||||||||||||||||| ||||| |
|
|
| T |
15182345 |
acttggcatgggggtaatatttttgggagatagtcttt-atcttggaaggtaaataaattcattt |
15182408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 72
Target Start/End: Original strand, 15211117 - 15211164
Alignment:
| Q |
24 |
catgggggtattatttttgggaaacaatcttttatcttggaaggtaaat |
72 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
15211117 |
catgggggtaatatttttgggagacaatc-tttatcttggaaggtaaat |
15211164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University