View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-1 (Length: 115)
Name: NF1504R-Insertion-1
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-1 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 42272906 - 42272809
Alignment:
| Q |
8 |
acttaaaataattgttgctatatgcatgttattgtcaataaattgtttgtcgctgcaaaaaagtcgttgtaaaatatgttatttcttgtatggtccaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272906 |
acttaaaataattgttgctatatgcatgttattgtcaataaattgtttgtcgctgcgaaaaagtcgttgtaaaatatgttatttcttgtatggtccaa |
42272809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 101357 - 101435
Alignment:
| Q |
19 |
ttgttgctatatgcatgttattgtcaataaattgtttgtcgctgcaaaaaagtcgttgtaaaatatgttatttcttgta |
97 |
Q |
| |
|
||||||||||| |||| |||||| ||| ||||| ||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
101357 |
ttgttgctataagcatattattgacaacaaattaattgtcgctgagaaaaagtcgttgctaaatatcttatttcttgta |
101435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 21 - 97
Target Start/End: Complemental strand, 165850 - 165774
Alignment:
| Q |
21 |
gttgctatatgcatgttattgtcaataaattgtttgtcgctgcaaaaaagtcgttgtaaaatatgttatttcttgta |
97 |
Q |
| |
|
||||||||| |||| |||||| ||| |||||| |||||||||| |||| |||| || |||||| |||||||||||| |
|
|
| T |
165850 |
gttgctataagcatattattgacaacaaattgattgtcgctgcgaaaatgtcgctgctaaatatcttatttcttgta |
165774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University