View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-20 (Length: 225)
Name: NF1504R-Insertion-20
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-20 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 69 - 225
Target Start/End: Original strand, 36221354 - 36221507
Alignment:
| Q |
69 |
ttactctcaagtcataaacattacaaaattttactacaacaaaatgaatatactaatcaaaattatcaaatccgtcaccaccctttgaaaagaaaatcaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36221354 |
ttactctcaagtcataaacattacaaaattttactacaacaaaatgaatatactaatcaaaattatcaaatccgtcaccacccttttaaaagaaaatcaa |
36221453 |
T |
 |
| Q |
169 |
atcaattccatcactaatcatcacactttgaaatcttaaacaatattgagtaacttc |
225 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36221454 |
atcaattccatcacta---atcacactttgaaatcttaaacaatattgagtaacttc |
36221507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 36221319 - 36221352
Alignment:
| Q |
8 |
aaatacaatatgcattgctgatcaaaattatcag |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36221319 |
aaatacaatatgcattgctgatcaaaattatcag |
36221352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University