View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-21 (Length: 217)
Name: NF1504R-Insertion-21
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 9 - 217
Target Start/End: Complemental strand, 44999286 - 44999082
Alignment:
| Q |
9 |
ccatttctatataacgttctcacatttctttatttatttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999286 |
ccatttctatataacgttctcacattt----atttatttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgtt |
44999191 |
T |
 |
| Q |
109 |
gatgtatgtaggcttgttgcgcccatagcttggtttgtgtgcctctctatgatactcttggtaatgaaataagaaattgtccatacatttacttcatcct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
44999190 |
gatgtatgtaggcttgttgcgcccatagcttggtttgtgtgcctctctatgatactcttggtaataatataagaaattgtccatacatttacttcatcct |
44999091 |
T |
 |
| Q |
209 |
cccctgttt |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
44999090 |
cccctgttt |
44999082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University