View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-26 (Length: 150)
Name: NF1504R-Insertion-26
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 4e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 9 - 150
Target Start/End: Original strand, 607698 - 607844
Alignment:
| Q |
9 |
gtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcctctgtaacgcctctttttacgatgtcc-----atgtgacgcgaaacctatcgagat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
607698 |
gtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcctctgtaacgcctctttttacgatgtccatattatgtgacgcgaaacctatcgagat |
607797 |
T |
 |
| Q |
104 |
atgtatatacaagattgcttgttttatcttttgtgacattggctcgt |
150 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
607798 |
atgtatatacaagattgcttgttctatcttttgtgacattgtctcgt |
607844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University