View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-27 (Length: 145)
Name: NF1504R-Insertion-27
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-27 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 9 - 145
Target Start/End: Original strand, 5474222 - 5474358
Alignment:
| Q |
9 |
agaagaattggtgcatcaatccatcaaggcaatcaaggcagaacaacaactaaaaaggaagagtcatgcaaagaagagaactaccgctctcaactctcaa |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474222 |
agaagaattggtgcatgaatccatcaaggcaatcaaggcagaacaacaactcaaaaggaagagtcatgcaaagaagagaactaccgctctcaactctcaa |
5474321 |
T |
|
| Q |
109 |
aattggaaggacaaacaaacaaaagaaaggagggttc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474322 |
aattggaaggacaaacaaacaaaagaaaggagggttc |
5474358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University