View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504R-Insertion-28 (Length: 145)
Name: NF1504R-Insertion-28
Description: NF1504R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504R-Insertion-28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 10 - 141
Target Start/End: Complemental strand, 22644751 - 22644620
Alignment:
| Q |
10 |
gacagtccctaacccccgtctgctgcaccgggaatatcatatccgtcaaagcactcttgttcctatttttccatacgtcataatacatggataggactga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644751 |
gacagtccctaacccccgtctgctgcaccgggaatatcatatccgtcaaagcactcttgttcctatttttccatacgtcataatacatggataggactga |
22644652 |
T |
|
| Q |
110 |
tttaatcacatgctccgattcactcacaatcc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22644651 |
tttaatcacatgctccgattcactcacaatcc |
22644620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 34 - 76
Target Start/End: Original strand, 34986122 - 34986165
Alignment:
| Q |
34 |
gcaccgggaatatcatatccgtcaaagca-ctcttgttcctatt |
76 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34986122 |
gcaccaggaatatcatatccttcaaagcatctcttgttcctatt |
34986165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 34 - 76
Target Start/End: Original strand, 34992941 - 34992984
Alignment:
| Q |
34 |
gcaccgggaatatcatatccgtcaaagca-ctcttgttcctatt |
76 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34992941 |
gcaccaggaatatcatatccttcaaagcatctcttgttcctatt |
34992984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University