View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_high_18 (Length: 332)
Name: NF1504_1D_high_18
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_high_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 7 - 332
Target Start/End: Complemental strand, 47029430 - 47029105
Alignment:
| Q |
7 |
caaacttcattaatggagaaggccaggactattacggctctagaaagaaggttgaaggttatgttagtcgaaaagggtgctaaggtggaagagctaaggc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47029430 |
caaacttcattaatggagaaggccaggactattacggccctagaaagaaggttgaaggttatgttagtcgaaaagggtgctaaggaggaagagctaaggc |
47029331 |
T |
 |
| Q |
107 |
tggccacaaaagagttacttcattaatggagaagtcaatcctatccgaggaggatctggaggccgtgaagaaagagaggagtttgctgctttaaagttga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47029330 |
tggccacaaaagagttacttcattaatggagaagtcaatcctatctgaggaggatctggaggccgtgaagaaagagaggagtttgctgctttaaagttga |
47029231 |
T |
 |
| Q |
207 |
gagggacggtttggtggaccaagtttgcaaagtacgtctggactcatttaataacgccattgcccagatccaacaattcaatcctggcgtggttttgaag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47029230 |
gagggacggtttggtggaccaagtttgcaaagtacgtctggactcctttaataacgccattgcccagatccaacaattcaatcctggcgtggttttgaag |
47029131 |
T |
 |
| Q |
307 |
ctggacgagcttgattgctgcaagga |
332 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47029130 |
ctggacgagcttgattgctgcaagga |
47029105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University