View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_high_28 (Length: 274)

Name: NF1504_1D_high_28
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_high_28
NF1504_1D_high_28
[»] chr4 (1 HSPs)
chr4 (22-267)||(32560614-32560859)
[»] chr2 (1 HSPs)
chr2 (98-165)||(10751111-10751178)


Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 22 - 267
Target Start/End: Original strand, 32560614 - 32560859
Alignment:
22 agttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatatcgaggtgattaagattgatgggaaaaaccctttcttgtggcat 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
32560614 agttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatattgaggtgattaagattgatgggaaaaaccctttcttgtggcat 32560713  T
122 gatcattggcctgttaaggactatgcaaaggtttttgagtgcttagtcctggttgatgaatttactcaagaagctgatagagttgcctctatgattagaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32560714 gatcattggcctgttaaggactatgcaaaggtttttgagtgcttagtcctggttgatgaatttactcaagaagctgatagagttgcctctatgattagaa 32560813  T
222 aagttggtagccatgatgataaaggtaattcatttcagtattatgt 267  Q
    |||||||||||||||||||||||||||||||||||||| |||||||    
32560814 aagttggtagccatgatgataaaggtaattcatttcagaattatgt 32560859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 98 - 165
Target Start/End: Original strand, 10751111 - 10751178
Alignment:
98 gggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgctt 165  Q
    ||||||||||||||||| |||||||||||||||||| | ||  |||||| ||||||||||||||||||    
10751111 gggaaaaaccctttcttatggcatgatcattggcctttgaaaaactatggaaaggtttttgagtgctt 10751178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University