View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_high_39 (Length: 236)
Name: NF1504_1D_high_39
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_high_39 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 47645182 - 47644956
Alignment:
| Q |
10 |
ggagttcgaggacaaataaacctcccaagctgtgcgagacaagtatcaccggcttccctccattggaattgcttgctttttctatcaaattctttaggtc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47645182 |
ggagttcgaggacaaataaacctcccaagctgtgtgagacaagtatcaccggcttccctccattggaattgcttgctttttctatcaaattctttaggtc |
47645083 |
T |
|
| Q |
110 |
gtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagaccatatcgaaaatcatagggagctccaaacagattctgaccatctatgtaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47645082 |
gtttaggaatttggaaccaacttgagatgggtgacttggtgctgctagaccatatcgaaaatcatagggagctccaaacagattctgaccatctatgtaa |
47644983 |
T |
|
| Q |
210 |
ccaagctgttctaatgattctactaag |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47644982 |
ccaagctgttctaatgattctactaag |
47644956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 31641879 - 31641730
Alignment:
| Q |
10 |
ggagttcgaggacaaataaacctcccaagctgtgcgagacaagtatcaccggcttccctccattggaattgcttgctttttctatcaaattctttaggtc |
109 |
Q |
| |
|
||||||| ||||||||||||||||| || ||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641879 |
ggagttcaaggacaaataaacctcctaatctgtgtgagacaagtattagtggcttccctccattggaattgcttgctttttctatcaaattctttaggtc |
31641780 |
T |
|
| Q |
110 |
gtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641779 |
gtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagac |
31641730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University