View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1504_1D_high_44 (Length: 223)

Name: NF1504_1D_high_44
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1504_1D_high_44
NF1504_1D_high_44
[»] chr7 (1 HSPs)
chr7 (9-205)||(32452113-32452308)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 205
Target Start/End: Original strand, 32452113 - 32452308
Alignment:
9 tggtgttcacttattggttattttgaacttctactatagtttgcacttgttggttatgctataggttattgccattctaaacttcaaccatagtcttcac 108  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||    
32452113 tggtgttcacttattggttattttgaacttctactatagtatgcacttattggttatgctataggttattgtcattctaaacttcagccatagtcttcac 32452212  T
109 ttattgataatgctataacttattgacatcttaagaactatgattgctcaactggcctatcccattaaattgtcatgataataatctgctaaagaag 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||    
32452213 ttattgataatgctataacttattgacatcttaagaactatgattgctcagctggcctatcctattaaa-tgtcatgataataatctgctaaagaag 32452308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University