View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_high_50 (Length: 206)
Name: NF1504_1D_high_50
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 32 - 193
Target Start/End: Complemental strand, 46093083 - 46092922
Alignment:
| Q |
32 |
tgtgtggcaaccacacgattgcgtgtggccaaaggaatccacttatcctctcaatgatgctcctgtcgtcatacaacagctacatatatcgactatatgg |
131 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46093083 |
tgtgtggcaaccacacgatagcgtgtggccaaaggaatccacttatcctctcaatgatgctcctgtcgtcatacaacagctacatatatcgactatatgg |
46092984 |
T |
 |
| Q |
132 |
cccaactgtctgaattttgtttatactaattatatgctcctttcattgattcgtaaccagaa |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46092983 |
cccaagtgtctgaattttgtttatactaattatatgctcctttcattgattcgtaaccagaa |
46092922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University