View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1504_1D_low_103 (Length: 205)
Name: NF1504_1D_low_103
Description: NF1504_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1504_1D_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 32183007 - 32183171
Alignment:
| Q |
17 |
tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183007 |
tttatgtttctgcttttgttggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgct |
32183106 |
T |
 |
| Q |
117 |
ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtgg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183107 |
ggttgtgggttgttgttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtgg |
32183171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 103 - 182
Target Start/End: Original strand, 15858910 - 15858990
Alignment:
| Q |
103 |
cagcagtgggtgctggttgtgggttgtt-gttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggt |
182 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15858910 |
cagcagtgggtgctggttctggggtgtttgttttagggcctgttttggtggcttgtggtgaggctgcgcgttgtttgtggt |
15858990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 15858870 - 15858905
Alignment:
| Q |
21 |
tgtttctgcttttgttggatggtagcagattttttg |
56 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15858870 |
tgtttctgcttttgttggatggtagcaaattttttg |
15858905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University